The results from Step 4 are shown in the table below - VCE - SSCE Biology - Question 33 - 2021 - Paper 1
Question 33
The results from Step 4 are shown in the table below. They compare a sequence of 20 bases between the echidna samples. Of the four samples, three were determined to ... show full transcript
Worked Solution & Example Answer:The results from Step 4 are shown in the table below - VCE - SSCE Biology - Question 33 - 2021 - Paper 1
Step 1
Echidna sample A
96%
114 rated
Only available for registered users.
Sign up now to view full answer, or log in if you already have an account!
Answer
The sequence for sample A is ATAGGCATGTCTCTGGAACT.
Step 2
Echidna sample B
99%
104 rated
Only available for registered users.
Sign up now to view full answer, or log in if you already have an account!
Answer
The sequence for sample B is ATTGGCACTGGCCTGGAACT.
Step 3
Echidna sample C
96%
101 rated
Only available for registered users.
Sign up now to view full answer, or log in if you already have an account!
Answer
The sequence for sample C is ATAGGCATGTCTCTGCGAAT.
Step 4
Echidna sample D
98%
120 rated
Only available for registered users.
Sign up now to view full answer, or log in if you already have an account!
Answer
The sequence for sample D is ATAGGCATGTCTCTGGAAT.
Step 5
Conclusion
97%
117 rated
Only available for registered users.
Sign up now to view full answer, or log in if you already have an account!
Answer
Comparing the sequences, sample B (ATTGGCACTGGCCTGGAACT) has a different nucleotide sequence from the others, indicating that it is the one most likely to be from New Guinea.
